biologia molecular -
Esta página já teve 132.568.046 acessos - desde 16 maio de 2003. Média de 24.701 acessos diários
home | entre em contato
 

biologia molecular

Evolução 5

11/06/2003

Neodarwinismo
 

A teoria da Evolução proposta por Darwin não explicava alguns passos do processo. Como apareciam, dentro de uma mesma espécie, animais ligeiramente diferentes um dos outros? Ou seja, porque alguns animais tinham a pelagem mais clara, outros mais escura, outros em tons intermediários, já que eram todos da mesma espécie? Essa variabilidade é justamente o que permite a ação da seleção natural. O darwinismo explicava bem o mecanismo da seleção natural, mas ainda faltavam algumas partes do quebra-cabeça...

Com o Neodarwinismo, ou Teoria Sintética da Evolução, estes passos foram explicados: Isto foi possível somente com o aparecimento da genética, estudos de célula, genes, cromossomos etc. O neodarwinismo (neo = novo) reconhece como principais fatores evolutivos a seleção natural, a recombinação gênica e a mutação. Vamos explicar cada um destes fatores.

Falamos em gene. Qual seria a relação entre um gene e a variabilidade encontrada? Ou seja, por que dizemos que uma mutação em um gene pode modificar ligeiramente uma característica? Vamos explicar tudo isto nesta página, mas para isso você necessita de alguns conceitos básicos. Queremos deixar bem claro que estas explicações são básicas, e na realidade existe muito mais a saber sobre genes, DNA e cromossomos. Nosso objetivo aqui é que você entenda o suficiente para acompanhar as idéias do estudo de Evolução.

 

Mas o que é DNA?

O DNA é uma molécula que existe praticamente em todas as células dos organismos vivos. Ela é conhecido como "molécula da vida", pois tem uma característica muito interessante: ela consegue se auto-duplicar, ou seja, essa molécula tem a capacidade de gerar uma cópia idêntica de si mesma. Para isso ela utiliza recursos presentes na própria célula, como proteínas, energia etc. O DNA é formado por duas cadeias de açúcares e fosfatos, ligadas por bases nitrogenadas. Essas bases (adenina, citosina, guanina e timina) se unem em uma ordem determinada. Assim, Adenina só se liga com Timina, e Citosina só se une à Guanina. Em cada uma das cadeias de DNA temos essas bases nitrogenadas. Podemos representar uma das fitas de DNA através de suas bases, assim:

A-T-G-C-A-A-C-G-T-A-G-C-C-T-A-A-G-T

 

Porém, como o DNA é uma dupla fita, devemos representar ambas as fitas:

A-T-G-C-A-A-C-G-T-A-G-C-C-T-A-A-G-T

T-A-C-G-T-T-G-C-A-T-C-G-G-A-T-T-C-A
     
     
Aqui uma representação tridimensional da molécula de DNA.   E aqui uma representação mostrando como as bases nitrogenadas se pareiam.
 

Repare que as bases se ligam em uma sequência determinada. É isso que permite ao DNA se duplicar com fidelidade. Quando vai se duplicar, o DNA "abre" suas cadeias, gerando duas fitas separadas. Cada uma das fitas incorpora novas bases (na sequência correta) e assim forma um novo DNA. Ou melhor, dois. De cada dupla fita de DNA teremos ao final duas novas moléculas no lugar da original.

Agora é sua vez: Abaixo você tem representado uma das fitas do DNA, como na hora da duplicação. Complete os espaços abaixo com as bases complementares. Utilize apenas letras maiúsculas. caso você acerte, a letra irá permanecer; se errar, aparece um símbolo (#). Para trocar de campo utilize o mouse:

 

ORIGINAL A G T C C A G T
NOVA CADEIA

Mas o que são os genes?

Genes são porções do DNA. Já vimos que o DNA é uma dupla cadeia contendo bases nitrogenadas. Essa fita pode conter uma quantidade imensa de bases; o gene seria um determinado trecho dentro do DNA. Os genes são fundamentais para a produção de proteínas, pois eles determinam o "molde" para a sequência de aminoácidos. Hoje sabemos que o conjunto de 3 bases em sequência determina um aminoácido, conforme a tabela abaixo. Mas como isso funciona?

 

Esta tabela apenas exemplifica o nosso raciocínio, mas ela não é completa. Note que combinações diferentes podem levar ao mesmo aminoácido.
 
 
Aminoácido Abreviatura Trinca codificadora
Leucina Leu AAT
Leucina Leu GAC
Leucina Leu GAA
Lisina Lys TTT
Valina Val CAG
Valina Val CAA
Valina Val CAC
Fenilalanina Phe AAA
Fenilalanina Phe AAG
Histidina Hys GTA
Histidina Hys GTG
Arginina Arg TCT
Arginina Arg TCC
Arginina Arg GCC
etc...
 
A tabela não está completa. É apenas um EXEMPLO para que você possa entender como o mecanismo funciona. Deu para notar que mais de uma sequência codifica o mesmo aminoácido, e além disso, algumas sequências não codificam nenhum. Ao todo são 20 aminoácidos produzidos por diferentes números de sequências.

Chamamos este sistema de código genético; sim, pois nada mais é do que um código, onde a sequência do DNA determina a síntese de uma proteína. Em primeiro lugar, vamos entender que existem dois tipos de proteínas: as enzimas, que são proteínas especiais, que contribuem em várias reações do organismo; e as proteínas estruturais, que estão presentes em vários locais, como por exemplo, na membrana de cada uma das células do organismo. Sendo assim, as proteínas acabam determinando as características de um indivíduo.

Bem, temos então um molde de DNA. Vamos supor que temos a seguinte sequência:

AATGACTTTCAGAAAAATCAATCTCACGTA

Cada conjunto de três bases corresponde à um amninoácido. Para visualizar melhor, vamos re-escrever a sequência acima, porém deixando um espaço de três em três bases:

AAT GAC TTT CAG AAA AAT CAA TCT CAC GTA

 

Seguindo nossa tabela, teríamos a formação da proteína com a seguinte sequência de aminoácidos:
 Sequência do DNA  AAT GAC TTT CAG AAA AAT CAA TCT CAC GTA
 Aminoácidos  Leu Leu Lys Val Phe Leu Val Arg Val His
Isto é apenas um exemplo. Uma proteína possui centenas de milhares de aminoácidos, cada uma em uma determinada sequência.

Bem, é desta maneira que o DNA controla a síntese de proteínas, servindo de molde. Quem realiza todo o trabalho são algumas enzimas (que capturam os aminoácidos, comparam a sequência de DNA, ligam um aminoácido no outro etc).

 

E o que são os cromossomos?

Já vimos que o DNA é uma dupla fita, que se estende formando uma sequência de bases. Vimos também que os genes são trechos de DNA, que tem a característica de serem o molde para uma determinada proteína ou característica. A fita de DNA é muito longa, isso com certeza poderia atrapalhar na hora da divisão celular (quando o DNA também tem que se dividir, indo cada uma das cópias para uma das células filha). Por isso o DNA se condensa, formando as estruturas que chamamos de cromossomos. Eles nada mais são do que o DNA altamente condensado.

Porém, todo o DNA de uma célula não se concentra em um único cromossomo. Cada espécie tem um número determinado de cromossomos; a espécie humana, por exemplo, tem um conjunto de 46 cromossomos, presentes nos núcleos de cada célula. Na verdade temos dois cromossomos de cada tipo, ou seja, eles formam duplas. As células chamadas diplóides possuem os cromossomos em pares; dizemos que são cromossomos homólogos. Nosso organismo possui em sua maioria células diplóides; nossas únicas células haplóides são os gametas (óvulos e espermatozóides). Quando os gametas se encontram (na fecundação) o material genético de ambos se une e o número diplóide volta a se reestabelecer.
   

 Isto é um cariótipo, ou seja, a representação dos cromossomos existentes em uma célula. Este não é um cariótipo humano; vimos que na espécie humana encontramos 46 cromossomos. 

Aqui temos 6 cromossomos, ou melhor, 3 pares de homólogos. neste esquema é possível identificar visualmente os cromossomos homólogos, pois eles são de tipos diferentes.

 

Os cromossomos homólogos não são idênticos; cada gene ocupa um lugar bem definido dentro do cromossomo, e este lugar se chama locus gênico. Os cromossomos homólogos possuem os mesmos loci gênicos, ou seja, os genes (ou melhor, os alelos) se distribuem da mesma maneira nos dois cromossomos.
 
 

 
    Vamos ilustrar isso com um exemplo: representamos os cromossomos com duas linhas verticais; eles são homólogos, possuem os mesmos loci gênicos. Assim, representamos os alelos A e a na mesma posição. 
 

 

Alelos?

Quando falamos em genes, falamos de uma sequência de DNA. Porém, o mesmo gene não precisa ser sempre idêntico. Por exemplo, imagine o gene A. Agora, imagine que em um pequeno trecho ele sofre uma modificação. Chamaremos este novo gene de a, pois ele é o mesmo gene, porém modificado. Estas duas formas (A e a) podem acontecer em cada um dos homólogos. Como o gene é o mesmo, não estaria certo falar gene A e gene a. Então, chamamos estes genes de alelos.

Alelos são os genes que ocupam o mesmo locus em cromossomos homólogos.

 

Como surge um alelo diferente?

Simples: por mutação. Pode ocorrer uma mutação em alguma das bases do gene, fazendo com que apareça um novo alelo. Assim, o alelo A pode sofre mutação gerando a, e vice-versa.

 

Finalmente a mutação...

A mutação nada mais é do que a mudança em uma ou mais bases do DNA. A síntese de DNA não está livre de erros. De vez em quando uma base errada se insere no lugar da outra, ou um trecho do DNA é perdido, ou substituído por outro. Na verdade são muitos os tipos de mutação, mas o que importa para nós é saber que a mutação ocorre no DNA, modificando sua estrutura, ou seja, criando um novo alelo para um determinado gene. Essa molécula de DNA modificada continua a se duplicar normalmente, ou seja, pode ser transmitida de forma hereditária para as futuras gerações.

Na verdade a maioria dos "erros" no processo de duplicação do DNA são corrigidos automaticamente por certas enzimas. mas alguns não são corrigidos. Ainda bem que é assim, pois isso permitiu criar toda a variabilidade que encontramos entre os organismos vivos.

Acompanhe abaixo como pode surgir uma mutação simples:

 Esquema de como ocorre uma mutação simples. Acompanhe cada cadeia por sua cor. Cadeias novas são formadas, porém onde há uma falha na duplicação é formada uma nova cadeia, diferente da original. Essa nova cadeia irá originar moléculas de DNA mutantes.

 

Apenas como curiosidade: é muito baixa a frequência para que ocorra uma nova mutação. Para se ter idéia a taxa de mutação para um determinado gene é estimada em 1 para 100 000. Isso varia de gene para gene, este número é apenas uma média. Mas isso quer dizer que de cada 100 000 genes que se duplicarem um deles apenas irá sofrer uma mutação.

Parece um número baixo, não? Mas agora imagine o total de gametas de um organismo. Se considerarmos todo o conjunto gênico, este número será mais alto. Vamos considerar que este organismo tem 10 000 genes por genoma (ou seja, em cada célula há este conjunto com 10 000 genes). Ora, se ocorre uma mutação a cada 100 000 genes, podemos esperar que de cada 10 gametas (óvulos e espermatozóides), pelo menos um possua uma nova mutação em algum gene.

www.ib.usp.br


IMPORTANTE

  •  Procure o seu médico para diagnosticar doenças, indicar tratamentos e receitar remédios. 
  • As informações disponíveis no site da Dra. Shirley de Campos possuem apenas caráter educativo.
Publicado por: Dra. Shirley de Campos
versão para impressão

Desenvolvido por: Idelco Ltda.
© Copyright 2003 Dra. Shirley de Campos